CIA used fake vaccination program to locate Osama Bin Laden

By setting up a fake Hepatitis B vaccination program in Abbottabad, CIA operatives were able to get DNA samples from Bin Laden’s family to verify that they were in the area. They compared them to samples from a deceased sister in Boston. (I reported on the DNA identification scheme of Bin Laden back in May after his death.)

Science meets spygames.

How did they verify bin Laden’s DNA?

You’ve no doubt got plenty of news blogs to follow for the latest on bin Laden’s death. One thing jumped out at me that I thought I should address on my science blog.

After announcing the death of terrorist mastermind Osama bin Laden yesterday, the US was careful to report that the body they recovered was verified to be that of Osama bin Laden. They used DNA testing in order to ensure that this was, in fact, the al Qaeda leader, comparing to a sample of brain tissue from his deceased sister (Edit: The accuracy of the DNA source being his deceased sister’s brain has been called into question, but there is no doubt that it was compared to some family member(s)’ DNA collected over the years by the CIA).

So how did they do that? What is DNA profiling? Today, most DNA profiling, or “fingerprinting”, is done by a technique called Short Tandem Repeat (STR) profiling. In various places in our genome, there are short repeated sequences of DNA.

For instance, on the long arm of your 5th chromosome, there’s a repeat region called CSF1PO. At this site, the sequence “AGAT” is repeated.

On one of my 5th chromosomes it might be repeated 7 times:

…AGATAGATAGATAGATAGATAGATAGAT…

while for you it might be repeated 5 times:

…AGATAGATAGATAGATAGAT…

The number of repeats at a certain spot are passed down to our children. Since we get one set of chromosomes from mom and one from dad, we have 2 different lengths at each STR site. 

The US uses a combination of 13 different STR sites to “fingerprint” someone’s DNA. A DNA sample (hair, tissue, etc.) is extracted from the person to be analyzed, the 13 loci are amplified by PCR, and the sizes of all the repeats are combined to provide a “fingerprint”.

While you and I might share the same number of repeats at one or two sites, the odds of us having the same repeat number at all 13 sites are close to zero (actually 1 in 575 trillion). When we look at someone’s complete STR profile on special machines, we can get a graphical look at their DNA fingerprint:

These tests can be done today in a matter of hours.  Osama and his sister would have shared at least one set of markers from their mother. By verifying that they shared a complete set of fingerprints inherited from their mom, we can say without a statistical doubt that the man the Navy SEALs killed was Osama bin Laden.